Шаблоны LeoTheme для Joomla.
GavickPro Joomla шаблоны

Research Article

High-Power Nd:YAG Laser Triggers Osteogenesis Through BMP-2 and IGF-1 Signaling Pathways In Osteoblasts

Lei Lei*1, Jingjing Xu, Jia Yan, Yaoyuan Chen

Department of Stomatology, Medical College, Jinan University, Guangzhou, Guangdong 510632, P.R. China.

*Corresponding author:     Dr. Lei Lei, Department of Stomatology, Medical College, Jinan University, 601 Western Huangpu Ave, Tianhe District, 510632 Guangzhou, P. R. China, Tel: +86-20-85227933; E-mail: tleil@jnu.edu.cn

Submitted11-02-2015 Accepted:  01-04-2016 Published: 1-13-2016

Download PDF

_________________________________________________________________________________________________________________________

 

Article


Abstract

In the present study, we demonstrated that high-power laser irradiation significantly increased the proliferation of MC3T3-E1 cells. The alkaline phosphatase (ALP) activity of MC3T3-E1 cells was distinctly enhanced after high-power laser irradiation, with an optimal effect observed following treatment for 5 seconds. After the exposure of laser irradiation, MC3T3-E1 cells got a higher level of calcium precipitation. Referring to molecular mechanisms, we found the endogenous gene expression of bone morphogenetic protein-2 (BMP-2) and insulin-like growth factor-1 (IGF-1) was significantly increased by laser irradiation. Furthermore, the protein level of core-binding factor alpha 1 (CBFA1) rose obviously after high-power laser irradiation. As a whole, this study indicated that high-power neodymium-doped yttrium aluminium garnet (Nd:YAG) laser could significantly increase osteoblast activity and efficiently accelerate calcium precipitation. In addition, the activation of BMP-2 and IGF-1 associated signaling pathways might be a molecular mechanism of osteogenesis triggered by Nd:YAG laser in osteoblasts.

Keywords: Nd:YAG laser; Proliferation; Differentiation; BMP-2; IGF-1

Abbreviations

Nd:YAG: Neodymium-Doped Yttrium Aluminium Garnet;

ALP: Alkaline Phosphatase;

BMP-2: Bone Morphogenetic Protein-2;

IGF-1: Insulin-Like Growth Factor-1;

CBFA1: Core-Binding Factor Alpha 1;

DMEM: Dulbecco’s Modified Eagle’s Medium;

FBS: Fetal Bovine Serum;

q-PCR: Quantitative Polymerase Chain Reaction;

GAPDH: Glyceraldehyde-3-Phosphate Dehydrogenase;

SDS: Sodium Dodecyl Sulfate;

PBS: Phosphate-Buffered Saline;

ELISA: Enzyme-Linked Immunosorbent Assay;

PDGF-α: Platelet-Derived Growth Factor-Α;

TGF-β: Transforming Growth Factor-Β

Introduction

Bone injury represents a variety of skeletal-related disorders, including defects that lead to major mobility hindrance andmortality in humans. It requires a long period of healing, which prolongs the patient’s hospitalization and suffering, andincreases the costs for their family and the society [1]. Certain risk factors, including poor blood circulation, loss of bone and soft tissue, metabolic disease, smoking, drinking, osteoporosis and high intraosseous pressure, may delay or impede bone healing in a clinical setting. Thus, in clinical, seeking ways to shorten healing periods and improve healing outcomes of bone injury is of great importance.

Nd:YAG laser therapy was first introduced into clinical settings by Berlien and Waldschmidt [2,3]. Using 17.7-mJ diode pump energy, 4.6-mJ long pulse energy was obtained from a 2-mm diameter and 20-mm long Nd:YAG crystal. The laser got an electrical-optical efficiency of 12.3% and was acousto-optically Q-switched. Furthermore, the Nd:YAG laser could generate 1.19 mJ and 108 ns pulses up to 100 Hz, when transversely pumped with a quasi-CW diode bar [4]. Currently, Nd:YAG laser is commonly used in clinical practice, with expanding roles including in pupilloplasty to widen a papillary phimosis and in dissection to lyse fibrotic vitreoretinal adhesions. The high-power pulse of Nd:YAG laser is partially attributed to the evolution of sharper focusing elements and shorter burst delivery times, enabling lower energy thresholds with which to perform procedures [5]. The advantage may be beneficial to bone formation in a restricted region such as bone loss in periodontal treatment and dental implant.

High-power lasers have also been adopted for bone regeneration [6]. However, how the high-power laser irradiation could affect osteoblast differentiation still remains unknown. Therefore, the present study aimed to explore the responses of osteoblasts to Nd:YAG laser irradiation and the underlying mechanisms for providing theory ground in bone formation with Nd:YAG laser.

Materials and Methods

Experimental design

Laser irradiation was conducted with a high peak power, Q-switched, pulsed Nd:YAG laser apparatus (PeriolaseMillennium Dental Technologies Inc., CA, USA). A 0.3-mm diameter optical fiber delivered the laser beam enabling uniform irradiation 3.5 cm over the cell layer. The parameters were as follows: Wavelength, 1,064 nm; output power, 0.8 W; and irradiation time, for 1, 2, 3, 4, 5 and 6 seconds. Laser irradiation was performed once per day for 7 days for the ALP activity assay and mineral deposition, or for the duration of the study in the other experiments. The control plate was placed on the non-irradiated bench during the laser exposure period of the experimental group.

Cell culture

MC3T3-E1 cells were cultured in 24-well with growth medium supplemented with Dulbecco’s modified Eagle’s medium (DMEM; Sigma-Aldrich, St. Louis, MO, USA), 10% fetal bovine serum (FBS; Gibco-BRL, Carlsbad, CV, USA) and 1% Penicillinstreptomycin (Gibco-BPL, Carlsbad, CV, USA) under cell culture  conditions of 370c in a humidified CO2 air environment. Osteogenic studies were performed in differentiation medium supplemented with DMEM, ascorbic acid (50 μg/mL), β-glycerophosphate (10 mM) and dexamethasone (1:1000).

Cell proliferation

Cell proliferation was assessed at day 1 and day 2 after laser irradiation by counting cells. The cell suspension w a s mixed with trypan blue solution. The first and second chambers of the hemocytometer (Yile Technologies Inc., Shanghai, China) were filled with the mixed suspension and the hemocytometer was placed onto the platform of an inverted microscope (Olympus Corporation, Tokyo, Japan). The cells were counted in grids with four angles. The cell concentration was calculated according to the following formula: Total number of four checks/4×104.

ALP activity

Cells cultured in differentiation medium (20,000 cells/cm2) were irradiated with laser for 7 days and ALP activity was assessed at 3, 7 and 14 days. By adding RIPA buffer, the cell lysates were extracted and treated with ultrasonic radiation (Koncrete Engineering Testing Technology Co., Ltd., Beijing, China) at 4˚C, then centrifuged at 10,000 g for 10 min at 4˚C. The supernatant was transferred into a 96-well plate, followed by the addition of ALP substrates (6.7 mmol/L p-nitrophenyl phosphate, 25 mmol/L diethanol-amine and 1 mmol/L  gCl2), t h e n , the plate was agitated in the dark for 30 min. Finally, the reaction was terminated by 0.05 N NaOH, and the absorbance was read at 405 nm.

Alizarin Red S Staining for Calcium Precipitation

Cells were fixed in 2.5% glutaraldehyde (freshly prepared in 1× phosphate-buffered saline (PBS) for 10-15 min at room temperature, then washed with 1× PBS 1-2 times. Filtered2% Alizarin Red solution (Sigma-Aldrich; pH adjusted to 4.2) was added to the fixed cells and placed in a 37˚C incubator for 10-20 min. The dye was removed and cells were rinsed with PBS 1-2 times. The staining results (positive stained nodules were orange red) were recorded with microphotography (UV/ Vis spectrophotometer; Beckman Coulter, Brea, CA, USA). For staining quantification, 800 μL of 10% acetic acid was added to each well and the plate was incubated at room temperature for 30 min with agitation. The monolayer was scraped from the plate and transferred with 10% (v/v) acetic acid into a microcentrifuge tube. Following vortexing for 30 sec, the slurry was overlaid with 500 μL mineral oil, heated to exactly 85˚C for 10 min and transferred onto ice for 5 min. The slurry was centrifuged at 20,000 g for 10 min and 500 μL supernatant was removed to a new microcentrifuge tube (Nalgene Labware, Thermo Fisher Scientific, Waltham, MA, USA). Subsequently, 200 μL of 10% (v/v) ammonium hydroxide was added to neutralize the acid. Aliquots (150 μL) of the supernatant were read in triplicate at 405 nm in a 96-well format using opaquewalled, transparent-bottom plates.

Quantitative polymerase chain reaction (q-PCR)

Total RNA was extracted using TRIzol reagent (Invitrogen Life Technologies, Carlsbad, CA, USA) following the manufacturer’s instructions, then diluted with diethylpyrocarbonate-treated water (1:40 dilution). Using a 10 μL microcuvette, the optical density was obtained at 260 and 280 nm to determine the sample concentration and purity; the required A260/A280 was >1.6. DNA was synthesized using a Transcriptor First Strand cDNA synthesis kit (Invitrogen Life Technologies, Carlsbad, CA, USA) according to the manufacturer’s instructions. The expression levels of genes and the reference gene, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were determined by SYBR-Green I q-PCR (Applied Biosystems, Foster City, CA, USA). GAPDH was used as a housekeeping gene for internal control and gene expression in each reaction was normalized by GAPDH expression. The PCR procedures were performed as previously described by Chen et al [6]. Primers were synthesized by Integrated DNA Technologies (Coralville, IA, USA), and the following primer sequences were used: for mouse ALP, forward GTTGCCAAGCTGGGAAGAACAC, reverse CCCACCCCCGCTATTCCAAAC; for mouse BMP-2, forward GGTCACAGATAAGGCCATTGC, reverse GCTTCCGCTGTTTGTGTTTG; for mouse IGF- 1, forward TGGATGCTCTTCAGTTCGTG, reverse CTTCAGTGGGGCACAGTACA; for mouse GAPDH, forward ACTCCACTCACGGCAAATTC, reverse TCTCCATGGTGGTGAAGACA.

Western blot

Cells cultured in growth medium for 2 days after laser irradiation were solubilized in lysis buffer for 30 min. The lysates were centrifuged (15,000 g) at 4˚C for 15 min. Equal amounts of the soluble proteins were denatured in sodium dodecyl sulfate (SDS), electrophoresed on a 12% SDS-polyacrylamide gel, transferred onto nitrocellulose membranes and probed with antibodies, including rabbit anti-mouse antibodies and β-actin antibody (Abcam, Cambridge, MA, USA). The β-actin served as an internal control to monitor equal protein loading. Immunoblotting bands were observed using the Odyssey infrared imaging system (LI-COR Biosciences, Lincoln, NE, USA). All the results were representatives of triplication.

Statistic analysis

All the data were analyzed using SPSS version 20.0 (IBM, Armonk, NY, USA) and presented as the mean ± standard deviation. Statistical analysis was performed using Student’s t-test. Values of P<0.05 were considered to be statistically significant.

Results and Discussion

Proliferation and differentiation of MC3T3-E1 cells were enhanced after Nd:YAG laser irradiation

Trypan blue analysis indicated that the proliferation of MC3T3-E1 cells was significantly enhanced in the experimental group compared with the non-laser control group 1 and 2 days after laser irradiation. Furthermore, the proliferation of MC3T3-E1 cells was enhanced most when cells were exposed to laser for 4 seconds compared with other durations (Figure 1A).

As for ALP activity assay, MC3T3-E1 cells were exposed to high-power Nd:YAG laser ranged from 1 to 6 seconds. Then, 3, 7 and 14 days after laser treatment ALP activity was measured. For all these above-mentioned detection time points, when the laser exposure lasted for 5 seconds, the ALP activity reached its peak level, which was significantly higher than that for the other exposure periods (1, 2, 3, 4 or 6 seconds). Furthermore, the ALP activity of MC3T3-E1 cells after laser irradiation was significantly increased compared with the non-laser control group (Figure 1B, C and D).

A, cells were exposed to laser irradiation for periods from 1 to 6 seconds. Then, cell proliferation was measured using a trypan blue assay 1 and 2 days after laser treatment. Compared with the non-laser control group, *P<0.05, **P<0.01 and ***P<0.001; compared with the irradiation lasting for 4 seconds, #P<0.05. B, C and D, cells were exposed to laser irradiation for periods from 1 to 6 seconds. After that, ALP activity was measured using enzyme-linked immunosorbent assay (ELISA) 3, 7 and 14 days after laser irradiation. Compared with the non-laser control group, *P<0.05, **P<0.01 and ***P<0.001; compared with the irradiation lasting for 5 seconds, #P<0.05.

regen fig 10.1
Figure 1.Proliferation and differentiation of MC3T3-E1 cells after high-power Nd:YAG laser irradiation

Nd:YAG laser irradiation triggered the Calcium Precipitation

Alizarin Red S staining assay demonstrated that the calcium precipitation in the experimental group treated with laser was significantly higher than that in the non-laser control group 14 and 21 days after treatment. In addition, the maximum levels of calcium precipitation were observed at both time points mentioned above when the irradiation period was 5 seconds (Figure 2).

regen_fig_10.2
Figure 2.Calcium precipitation triggered by high-power Nd:YAG laser in virto.

Cells were exposed to laser irradiation for periods from 1 to 6 seconds. Then, calcium precipitation was examined via Alizarin Red S staining method 14 and 21 days after laser irradiation. Compared with the non-laser control group, *P<0.05, **P<0.01 and ***P<0.001; compared with the irradiation lasting for 5 seconds, #P<0.05, and ##P<0.01.

Nd:YAG laser irradiation increased the mRNA expression levels of ALP, BMP-2 and IGF-1

The q-PCR results illustrated that ALP mRNA transcription in the experimental group was significantly increased compared with the non-laser control group 3 and 7 days after lasertreatment. In addition, the highest ALP mRNA level was seen when cells were exposed to laser for 5 seconds (Figure 3A). Similarly, the mRNA expression levels of BMP-2 and IGF-1 were also significantly enhanced compared with the nonlaser control group, with the highest levels observed when the irradiation lasting for 5 seconds (Figure 3B and C).

regen_fig_10.3

Figure 3.Gene expression of ALP, BMP-2 and IGF-1 induced by highpower Nd:YAG laser.

Cells were exposed to laser irradiation for periods from 1 to 6 seconds. Then, gene expression of ALP (A), BMP-2 (B) and IGF-1 (C) was detected using RT-PCR 3 and 7 days after laser irradiation. Compared with the non-laser control group, *P<0.05, **P<0.01 and ***P<0.001; compared with the irradiation lasting for 5 seconds, #P<0.05, and ##P<0.01.

Cellular CBFA-1 was upregulated by Nd:YAG laser irradiation

CBFA1 is considered to be associated with the osteoblastic gene expression and the formation of bone. Thus, the level of CBFA1 was detected in MC3T3-E1 cells after laser irradiation. The results demonstrated that both 3 and 7 days after laser treatment the protein level of CBFA1 was significantly enhanced compared with the non-laser control group. Besides, an optimal expression of CBFA1 was noticed when MC3T3-E1cells experienced an irradiation lasting for 5 seconds (Figure 4).

regen_fig_10.4
Figure 4.Protein expression of CBFA1 induced by high-power Nd:YAG laser

Cells were exposed to laser irradiation for periods from 1 to 6 seconds. CBFA1 protein expression was detected via western blot 3 and 7 days after laser irradiation (A) and statistically analyzed (B). Compared with the non-laser control group, *P<0.05, **P<0.01 and ***P<0.001; compared with the irradiation lasting for 5 seconds, #P<0.05, ##P<0.01 and ###P<0.001.

Application of laser therapy and its role in cell proliferation

High-power laser therapy has been utilized in the clinical settings to optimize the wound environment, including stimulating angiogenesis and local blood flow, interstitial fluid flow and edema reduction [7,8]. The laser is also able to improve wound perfusion, stimulate growth factor induction and upregulate cytokines expression and cellular activity [9]. Thus, enhancing the formation of granulation tissue and improving wound-healing parameters are critical for increasing early blood supply and restarting bone tissue healing [10]. However, the specific function of the high-power laser in bone injury repair is elusive and requires investigation. Therefore, in the present study, the effects of the high-power laser on osteogenesis in MC3T3-E1 cells were examined.

The present study demonstrated that cell proliferation was increased significantly when cells were treated with the highpower laser. This result is consistent with previous studies demonstrating that the laser promoted the proliferation and migration of primary cultured human gingival epithelial cells [11]. However, there are also certain tissues demonstrating that only the low-power laser, and not the high-power laser, promotes the proliferation of human periodontal ligament cells [12]. Wu et al [13] also revealed that low-power laser irradiation was able to promote the proliferation of D1 cells. Thus, the underlying mechanisms of the induction of cell proliferation by the high- or low-power laser remain unknown.

The laser treatment period for stimulating cell proliferation is currently debated. The present study revealed a dosedependent increase in MC3T3-E1 cell proliferation, with an optimal period of 4 seconds with high-power laser treatment. To verify whether a longer laser irradiation period promoted greater cell proliferation, the period was prolonged to 5 and 6 seconds. However, cell proliferation was reduced at these two longer periods. These results reinforce the observation that the high-power laser promotes the proliferation of MC3T3-E1 cells. However, the optimal high-power laser treatment conditions for cell proliferation require further investigation with distinct cell types and laser parameters.

Role of laser in cell differentiation

In contrast to the unsure suppression of cell proliferation, the laser facilitated osteoblast differentiation. It demonstrated enhanced early and late stage osteogenic activities, as determined by ALP activity and in vitro matrix mineralization, respectively. ALP is recognized as an important early biomarker that is used to evaluate bone metabolism [14,15]. Khadra et al [16] demonstrated that ALP activity increased following exposure to 3 J/cm2 of laser irradiation. Furthermore, Fukuhara et al [17] revealed that a GaAIAs laser at an energy density of 3.75 J/cm2 significantly increased bone nodule area, as measured by von Kossa staining and subsequent determination of the number of ALP-positive colonies of calvarial cells. Similar results were also observed in the present study when the activity of ALP was assessed.

Mechanisms underling high-power laser induced cell proliferation and differentiation

The specific mechanisms underlying the promotion of proliferation and the differentiation of cells by high-power laser irradiation remain to be elucidated. Numerous growth factors, including BMP-2 [18,19], IGF-1 [20], platelet-derived growth factor-α (PDGF-α) [21] and transforming growth factor-β (TGF-β) [22], have been reported to regulate stem cell proliferation and differentiation. As one of the strongest factor, BMP-2 plays a critical role in inducing bone formation. IGF-1 demonstrated an ability to form bone nudoles. The present data documented the gene expressions of ALP, BMP-2 and IGF- 1 were gradually increased with the exposure time extension (from 1 to 5 second), especially later two factors peaked at 5 seconds, which indicated high-power laser irradiation regulates osteogenic differentiation via the BMP-2, IGF-1 and ALP. However, further studies are required to investigate the precise signaling pathways that are involved.

Role of high-power laser in calcium precipitation

In this study, calcium precipitation was detected via Alizarin Red S staining assay. The calcium precipitation induced by laser irradiation was obviously increased, with an optimal period of 5 seconds with laser treatment. The calcium precipitation in the high-power laser treated cells may result from the activation of ALP and increased IGF-1gene express, which is similar to results found in previous studies [23,24].

Further influence of high-power laser on CBFA1

CBFA1, an important transcription factor, is essential for osteoblast differentiation and thus for skeletal morphogenesis [25]. CBFA1 is stable during cell division, remains associated with chromosomes during mitosis and is important in the integration, organization and combinatorial assembly of DNA and its regulatory factors within the three dimensional context of the nuclear architecture. CBFA1, as an osteoblast-specific transcription factor, initiates the differentiation of osteoblasts  and regulates the expression of osteoblast-specific genes during differentiation [26]. In the present study, the expression of CBFA1 increased as a result of treatment with high-power laser. By contrast, the present study and previous studies have demonstrated that high-power laser treatment increases the responsiveness of osteoblasts to cytokines that promote osteoblast proliferation, differentiation and bone formation, including BMP-2 and IGF-1. These cytokines regulate the expression and activity of CBFA1 during osteogenesis [27, 28].

Conclusion

In this study, we demonstrated that high-power Nd:YAG laser irradiation promotes osteogenic activities, including ALP activity, gene expression of ALP, BMP-2 and IGF-1, as well as protein expression of CBFA1. The increased expression of BMP- 2 and the upstream regulator CBFA1 may be important in the high-power Nd:YAG laser stimulated osteoblast differentiation. Taken together, the present findings indicate that high-power Nd:YAG laser is able to reinforce osteoblast differentiation and bone formation in vitro, and also its application for osteogenic therapy in the future.

Acknowledgements

The present study got the kind help from Dr. Mark Reynolds, school of dentistry, University of Maryland in USA, and was supported by the Nature Science Foundation of Guangdong Province, P. R. China (Grant No. 8151063201000065).

Conflict of Interest Statement

The authors have stated explicitly that there is no conflicts interest.

References

References

1.Kerachian MA, Harvey EJ, Cournoyer D, Chow TY, Sequin C. Avascular necrosis of the femoral head: vascular hypotheses. Endothelium. 2006, 13(4): 237-244.

2.Berlien HP, Waldschmidt J, Muller G. Laser treatment of cutaneous and deep vessel anomalies. In: Waidelich W, editor. Laser optoelectronics in medicine. Berlin, Heidelberg, New York: Springer: 1988, 526-528.

3.Philipp C, Berlien HP, Potke M, Waldschmidt J. Ten years of laser treatment of congenital vascular disorders-technical techniques and results. Proc Spine.1994, 2327: 44-53.

4.Kundu P, Joseph CS, Chandrasekaran N. High efficiency diode laser side-pumped Nd:YAG rod laser. Opt Laser Eng. 2001, 36(1): 65-73.

5.Gibran SK, Kapoor KG. Nd:YAG laser posterior synechiolysis expands the spectrum of Nd:YAG laser-a case report. Med Laser APP, 2010, 25(1): 53-55.

6.Chen S, Yang L, Lu X, Li B, Chan JY et al. Gene expression profiling of CD3 gamma, delta, epsilon, and zeta chains in CD4(+) and CD8(+)T cells from human umbilical cord blood. Hematology. 2010, 15(4): 230-235.

7.Zhu JT, Xuan M, Zhang YN, Liu HW, Cai JH et al. The efficacy of autologous platelet-rich plasma combined with erbium fractional laser therapy for facial acne scars of acne. Mol Med Rep. 2013, 8(1):233-237.

8.de Abreu GM, Santo AM, Martin AA, Arisawa EA. Assessment of changes in mineral components in bone repair after laser therapy and pharmacotherapy by micro-EDX: a new potential tool in medical diagnosis. Photomed Laser Surg. 2013, 31(8): 378-385.

9.Hua YY, Wang XS, Zhang Y, Yao CG, Zhang XM et al. Intense picosecond pulsed electric fields induce apoptosis through a mitochondrial-mediated pathway in Hela cells. Mol Med Rep. 2012, 5(4): 981-987.

10.Brownlow HC, Reed A, Simpson AH. The vascularity of atrophic non-unions. Injury. 2002, 33(2): 145-150.

11.Ejiri K, Aoki A, Yamaguchi Y, Ohshima M, Izumi Y. High-frequency low diode laser irradiation promotes proliferation and migration of primary cultured human gingival epithelial cells. Lasers Med Sci. 2014, 29(4):1339-1347.

12.Wu JY, Chen CH, Yeh LY, Yeh ML, Ting CC et al. Low-power laser irradiation promotes the proliferation and osteogenic differatiation of human periodontal ligament cells via cyclic adenosine monophoshpate. Int J Oral Sci. 2013, 5(2): 85-91.

13.Wu JY, Wang YH, Wang GJ, Ho ML, Wang CZ et al. Low-pow-er GaAIAs laser irradiation promotes the proliferation and osteogenic differentiation of stem cells via IGF1 and BMP2. PLoS One. 2012, 7(9): e44027.

14.Datta P, Ghosh P, Ghosh K, Maity P, Samanta SK et al. In vitro ALP and osteocalcin gene expression analysis and in vivo biocompatibility of N-methylene phosphonic chitosan nanofivers for bone regeneration. J Biomed Nanotechnol. 2013, 9(5): 870-879.

15.Deng K, Yu AX, Xia CY, Li ZH, Wang WY. Combination of negative pressure wound therapy with open bone grafting for bone and soft tissue defects. Mol Med Rep. 2013, 8(2): 468-472.

16.Khadra M, Lyngstadaas SP, Haanaes HR, Mustafa K. Effects of laser therapy on attachment, proliferation and differentiation of human osteoblast-like cells cultured on titanium implant material. Biomaterials. 2005, 26(17): 3503-3509.

17.Fukuhara E, Goto T, Matayoshi T, Kobayashi S, Takahashi T. Optimal low-energy laser irradiation causes temporal G/M arrest on rat calvarial osteoblasts. Calcif Tissue Int. 2006, 79(6): 443-450.

18.Liu D, Hu L, Zhang Z, Li QY, Wang G. Construction of human BMP2-IRES-HIF1amu adenovirus expression vector and its expression in mesenchymal stem cells. Mol Med Rep. 2013, 7(2):659-663.

19.Moore NM, Lin NJ, Gallant ND, Becker ML. Synergistic enhancement of human bone marrow stromal cell proliferation and osteogenic differentiation on BMP-2-derived and RGD peptide concentration gradients. Acta Biomater. 2011, 7(5): 2091-2100.

20.Li Y, Xu Y, Li X, Qin Y, Hu R. Effects of PPAR-alpha against and IGF-1 on estrogen sulfotransferase in human vascular endothelial and smooth muscle cells. Mol Med Rep. 2013, 8(1): 133-139.

21.Kim MJ, Kim SK, Park HJ, Chung DH, Park HK et al. PDGFRA promoter polymorphisms are associated with the risk of papillary thyroid cancer. Mol Med Rep. 2012, 5(5): 1267- 1270.

22.Huang X, Lee C. Regulation of stromal proliferation, growth arrest, differentiation and apoptosis in benign hyperplasia by TGF-beta. Front Biosci. 2003, 8: s740-s749.

23.Kim IS, Cho TH, Kim K, Weber FE, Hwang SJ. High power- pulsed Nd:YAG laser as a new stimulus to induce BMP- 2 expression in MC3T3-E1 osteoblasts. Lasers Surg Med. 2010, 42(6): 510-518.

24.Shimizu N, Mayahara K, Kiyosaki T, Yamaguchi A, Ozawa Y et al. Low-intensity laser irradiation stimulates bone nodule formation via insulin-like growth factor I expression in rat calvarial cells. Lasers Surg Med. 2007, 39(6): 551-559.

25.Otto F, Thornell AP, Crompton T, Denzel A, Gilmour K. Cbfa1, a candidate gene for cleidocranial dysplasia syndrome, is essential for osteoblast differentiation and bone development. Cell. 1997, 89(5): 765-771.http://www.ncbi.nlm.nih.gov/pubmed/9182764

26.Dai Z, Wu F, Chen J, Xu H, Wang H et al. Actin microfilament mediates osteoblast Cbfa1 responsiveness to BMP-2 under simulated microgravity. PLoS One. 2013, 8(5): e63661.

27.Dai Z, Wang R, Ling S, Wan Y, Li Y. Simulated microgravity inhibits the proliferation and osteogenesis of rat bone marrow mesenchymal stem cells. Cell Prolif. 2007, 40(5): 671-684.

28.Zhu Y, Ouyang Y, Chang Y, Luo C, Xu J et al. Evaluation of the proliferation and differentiation behaviors of mesenchymal stem cells with partially converted borate glass containing different amounts of strontium in vitro. Mol Med Rep. 2013, 7(4): 1129-1136.

Cite this article: Lei L. High-Power Nd:YAG Laser Triggers Osteogenesis Through BMP-2 and IGF-1 Signaling Pathways In Osteoblasts. J J Regener Med. 2016, 1(3): 010.

Contact Us:
9600 GREAT HILLS
TRAIL # 150 W
AUSTIN, TEXAS
78759 ( TRAVIS COUNTY)
E-mail : info@jacobspublishers.com
Phone : 512-400-0398